what are recombinant plasmids used for
no. An expression vector, otherwise known as an expression construct, is usually a plasmid or virus designed for gene expression in cells. Combination attenuation offers strategy for live attenuated coronavirus vaccines. Store the glycerol stock in 80 C freezer for future use (stock should be stable for years). no. ).They play a critical role in such procedures as gene cloning, recombinant protein production (e.g., of human insulin), and gene therapy research. To make 10% or 2% FBS medium, add 55 or 10 mL FBS into 500 mL high-glucose DMEM supplemented with 1% penicillin/streptomycin solution, respectively. Nature 582, 561565 (2020). The plasmid is isolated and treated with the same restriction enzyme as the target gene. wrote the manuscript. For pCC1 vector-derived plasmids, inoculate the colonies into a 50-mL conical tube containing 10 mL LB broth containing 12.5 g mL1 chloramphenicol. 70% ethanol is still flammable. Our experimental design is to clone seven cDNA fragments covering the entire genome of SARS-CoV-2 into plasmid vectors, resulting in seven plasmids. Adjust the pH to 5.2 using glacial acetic acid. Mix the reactions by vortexing for 5 s. Centrifuge at >12,000 r.p.m. Article Dispense the medium into a waste container containing 20% bleach. The protocol described below will recover enough high-quality DNA fragments for more than two in vitro ligation reactions. X.X., V.D.M. A recombinant plasmid is a plasmid into which a foreign DNA fragment or gene has been inserted. CCIS125), Dulbeccos modified Eagles medium (DMEM), high glucose (Life Technologies, cat. 101093-752), 250-mL glass bottle (Duran, cat. no. The DNA fragments can be used immediately or stored at 4 C until use. The resulting genome-length viral RNA was subsequently electroporated into cells to recover recombinant SARS-CoV-2. for 5 h, then use the induced cultures for Miniprep. Menachery, V. D. et al. Synthesize the first-strand cDNA from 11 L isolated RNA using SuperScript IV reverse transcriptase (according to the manufacturers instructions). mBio https://doi.org/10.1128/mBio.00665-17 (2017). In option B, RNA transcripts are electroporated into BHK-21 cells and the electroporated BHK cells are seeded onto a monolayer of Vero E6 cells. First, it permits rapid generation of mutant and reporter viruses by manipulation of a smaller plasmid (i.e., the plasmid that contains the targeted mutation fragment), reducing the risk of off-target mutations or deletions being inadvertently incorporated into the recombinant virus. AM9722), Ampicillin sodium salt (Sigma-Aldrich, cat. The SARS-CoV-2 infectious complementary DNA (cDNA) clone utilizes an in vitro ligation approach that was pioneered with other coronaviruses, including transmissible gastroenteritis virus (TGEV), mouse hepatitis virus (MHV), and the original severe acute respiratory syndrome coronavirus (SARS-CoV)5,6,7. For pCC1-derived plasmids, an extra induction step (Step 14) is needed. Plasmids are physically separate from chromosomal DNA and replicate independently. Once a segment of DNA has been cloned, its nucleotide sequence can be determined. In general, we find it necessary to complete a maxiprep (Qiagen) for each plasmid to have sufficient DNA concentrations to facilitate full-length cDNA assembly. Clarify the PCR products using the Microspin G-25 columns according to the manufacturers instructions to remove extra dNTPs from the PCR reactions. lacZ encodes the enzyme -galactosidase which can hydrolyse lactose. Add 200 L phenol:chloroform:isoamyl alcohol 25:24:1. They typically have a small number of genes notably, some associated with antibiotic resistance and can be passed from one cell to another. The final working concentrations are 100 g mL1 for ampicillin and 12.5 g mL1 for chloramphenicol. https://doi.org/10.1038/s41596-021-00491-8, DOI: https://doi.org/10.1038/s41596-021-00491-8. d,e, Representative agarose gels from successful (d) and unsuccessful (e) attempts to generate in vitro transcribed full-length SARS-CoV-2 viral RNA prior to electroporation and virus recovery. The pellets can be either used immediately or preserved at 20 C for several weeks until use. Creation of recombinant DNA Molecular Cloning. Thank you for visiting nature.com. Although the electroporation buffer improves the efficiency in Vero E6 cells, we also include an alternative approach utilizing BHK-21 cells, a Golden Syrian hamster fibroblast cell line that can be used for virus generation in other CoV systems6,7. Equal molar concentrations of each fragment should be used for the ligation in this protocol. By submitting a comment you agree to abide by our Terms and Community Guidelines. The SARS-CoV-2 N-gene cDNA is prepared from the plasmid pCC1-CoV-2-F7 via PCR with a pair of primers CoV-T7-N-F (tactgTAATACGACTCACTATAGGatgtctgataatggaccccaaaatc and polyT-N-R [(t)37aggcctgagttgagtcagcac]. Each bacterium with a plasmid gives rise to a cluster of identical, plasmid-containing bacteria called a colony. Adjust the final volume to 1 L using deionized water and filter-sterilize. The colonies may vary in size due to potential cryptical foreign gene expression from viral genome, which is usually toxic to the E. coli. Ligate F1, F2, F3 and F4 in a 0.2-mL PCR tube to produce F14 DNA, and ligate F5, F6 and F7 in a separate PCR tube to produce F57 DNA. Centrifuge at maximum speed for 2 min at room temperature and carefully decant the supernatant. 4446-250), Falcon 15-mL conical tube (Corning, cat. Plasmids are used to prepare recombinant DNA with the desired gene to transfer genes from one organism to another. 4446-1L), Erlenmeyer flask, 250 mL (Pyrex, cat. Keep the competent cells on ice prior to heat shock. Harvest the supernatants at 48 h post-infection (defined as P1) by centrifuging at 1,000g for 10 min at 4 C. N. Engl. P.-Y.S. Incubate at room temperature or 56 C incubator for 2 min. recombinant DNA, molecules of DNA from two different species that are inserted into a host organism to produce new genetic combinations that are of value to science, medicine, agriculture, and industry. The purified DNAs can be used immediately or stored at 20 C until use. Use fresh cells with 8090% of confluence prior to electroporation to ensure cells are at the exponential growth stage. no. A DNA polymerase with high fidelity is used to avoid errors occurring during DNA amplification. Scobey, T. et al. However, the methods applied for bacterial genome engineering are still challenging and . Before transformation, complete the following steps: Quantify the concentration of each plasmid using a spectrophotometer, Disinfect the bench surface with 70% ethanol, Light a Bunsen burner to provide a sterile environment for transformation. no. The recombinant DNA technology plays an important role in the production of DNA vaccines. We also note that each plasmid has prescribed competent cells (Top10 or EPI300), which are associated with lower mutation and deletion frequencies as well as improved plasmid yields. During the incubation period, warm LB agar plates supplemented with 100 g mL1 ampicillin (for pUC57-derived plasmids) or 12.5 g mL1 chloramphenicol (for pCC1-derived plasmids) in a 37 C incubator. Load the recovered DNA samples for agarose gel electrophoresis to examine the quality of the purified DNA. Before electroporation, replace the culture media of Vero E6 flasks with 8 mL fresh media containing 5% FBS and 1% antibiotics. Pellet down the cultures by spinning at 7,000 r.p.m. It replicates independently of chromosomal DNA. Incubate the reactions for transcribing SARS-CoV-2 full-length RNA at 32 C for 8 h. Incubate the reactions for transcribing SARS-CoV-2 N RNA at 37 C for 3 h. Add 12 L DNase to digest the DNA templates for 15 min at 37 C. Construction of recombinant DNA, in which a foreign DNA fragment is inserted into a plasmid vector. no. no. Evaluate the results for each plasmid, referring to Table 1 for expected fragment sizes. Keep stocks away from fire. 27106), QIAquick gel extraction kit (Qiagen, cat. Mix the reactions thoroughly by gently taping the tube. Peer review information Nature Protocols thanks Jasper Chan and Ailong Huang for their contribution to the peer review of this work. It is ideal for amplifying large, unstable and bacteria-toxic DNA fragments in E. coli. 12361010), QIAGEN plasmid maxi kit (Qiagen, cat. In this report, we describe the technical information and detailed protocols for utilizing this reverse genetic tool. It can be propagated in E. coli to produce a high yield of plasmids for downstream use. It is also very common to use a recombinant plasmid to express large amounts of a known gene to obtain RNA or protein from it. Gently aspirate the cells out of the cuvette and transfer cells in a new T75 flask containing 15 mL culture medium supplemented with 10% FBS. Collect as many of the cells as possible. Keywords Plasmids The cDNA can be used immediately or stored at 20 C for future use. Nature https://doi.org/10.1038/s41586-020-2895-3 (2020). Knowledge of the sequence of a DNA segment has many uses. Mulligan, M. J. et al. This section describes how to recover the SARS-CoV-2 recombinant virus from cell culture via RNA electroporation. To obtain Weigh out 484 mg Tris-base in a clean 2-L glass bottle and add ~1,500 mL UltraPure deionized water. Chloramphenicol aliquots may be kept in a 20 C freezer for at least 1 year. Gralinski, L. E. & Menachery, V. D. Return of the coronavirus: 2019-nCoV. Troubleshooting advice can be found in Table 3. The ability to obtain specific DNA clones using recombinant DNA technology has also made it possible to add the DNA of one organism to the genome of another. The following year American microbiologist Hamilton O. Smith purified so-called type II restriction enzymes, which were found to be essential to genetic engineering for their ability to cleave at a specific site within the DNA (as opposed to type I restriction enzymes, which cleave DNA at random sites). Coelectroporation with N-gene RNA is used in this protocol because N protein can enhance the infectivity of coronavirus RNA5,6,24. Plasmids have been key to the development of molecular biotechnology. Place the cuvette into the Gene Pulser Xcell electroporation system quickly and apply a single electrical pulse with a setting of 270 V at 950 F (see equipment setup for more details). Natl Acad. Stage 5 (Step 97) involves recovery of the SARS-CoV-2 recombinant virus from cell culture via RNA electroporation. no. In this way a designer organism is made that contains some specific change required for an experiment in basic genetics or for improvement of some commercial strain. Top10 competent cells are recommended. Wash the flask one more time with 12 mL culture medium. How is recombinant DNA technology useful? In such procedures, a plasmid is cut at a specific site (or sites) using enzymes called restriction . Dissolve 246.1 g sodium acetate in 500 mL deionized water. Keep the Shockpod in the hood and the rest of the electroporator outside the hood. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate. Add 100 mL UltraPure deionized water and stir thoroughly until components are completely dissolved. Cloning is undertaken in order to obtain the clone of one particular gene or DNA sequence of interest. 21, 15081513 (2015). 2a). Nature 586, 589593 (2020). no. 5b). a. Engineering SARS-CoV-2 using a reverse genetic system, https://doi.org/10.1038/s41596-021-00491-8. RNA transcripts are electroporated into BHK-21 cells, and the electroporated BHK cells are seeded onto a monolayer of Vero E6 cells. no. Inoculate 0.1 mL glycerol stock into a 250-mL Erlenmeyer flask containing 50 mL LB medium supplemented with appropriate selective antibiotics. and P.-Y.S. Plasmids naturally exist in bacterial cells, and they also occur in some eukaryotes.. Use one column for each DNA fragment. Aliquot the P0 virus as 500 L per tube, and store the viruses in 80 C freezer for future use. To combat this newly emerged coronavirus, we have developed a reverse genetic system to generate recombinant viruses to characterize the biology of SARS-CoV-2 and develop vaccines and therapeutics (Fig. https://doi.org/10.1056/NEJMoa2027906 (2020). Elute final DNA in 60 L nuclease-free water (prewarmed at 56C), and determine the concentration using spectrometer. was supported by NIH grants AI142759, AI134907, AI145617 and UL1TR001439, and awards from the Sealy & Smith Foundation, Kleberg Foundation, the John S. Dunn Foundation, the Amon G. Carter Foundation, the Gilson Longenbaugh Foundation, and the Summerfield Robert Foundation. Thus, all of the bacteria are placed on an antibiotic plate to select for ones that took up a plasmid. Another key barrier to success with our reverse genetic system is deletions and mutations while propagating the cDNA plasmids. Set up a 50-L digest reaction system with appropriate restriction enzymes for each plasmid according to the table below. Keep the Shockpod in the hood and the rest of the electroporator outside the hood. Measure the quantity and quality of DNA using a spectrometer and load 1 L of RNA samples onto a 0.8% agarose gel to examine the quality of RNA (Fig. However, recombinant DNA technology has made it possible to isolate one gene or any other segment of DNA, enabling researchers to determine its nucleotide sequence, study its transcripts, mutate it in highly specific ways, and reinsert the modified sequence into a living organism. Place the plates upright in a 37 C incubator for 30 min to allow the cultures to be fully absorbed. Inappropriate temperature would decrease transformation efficiencies. was partially supported by NIH5UC7AI094660. G9012), Hydrogen chloride (HCl; 36.538%; Sigma-Aldrich, cat. Split Vero E6 cells 1 d before electroporation to ensure 8090% confluence the next day. In the meantime, to ensure continued support, we are displaying the site without styles The steps involving cell culture should be performed in a sterile environment in a biosafety cabinet. Incubate the mixtures at room temperature for 1530 min to precipitate DNA. 11, 5214 (2020). Timing 1 h for electroporation and 24 d for recovering viruses. The recombined DNA molecule is inserted into a host organism to produce new genetic combinations that are of value to science, medicine, agriculture, and industry. They write new content and verify and edit content received from contributors. 25200-072), 0.4% (wt/vol) Trypan blue (Thermo Fisher Scientific, cat. Plasmids that are used most commonly in the field of recombinant DNA technology have been optimized for their use of studying and manipulating genes. Set up two separation ligations (A and B) according to the table below. This recombinant plasmid contains (1) a promoter that enables transcription of desired gene, (2) a sequence for the initiation of DNA replication ( ori site), and (3) an antibiotic resistance gene. We optimized the parameter settings including voltages, capacitance and pulse times for different cells. Organic reagents such as phenol:chloroform:isoamyl alcohol, chloroform and isopropanol are toxic.
An Example Of A Warning Sign Is Quizlet,
224 D Cornwall St Nw Leesburg, Va 20176,
Holy Trinity Church San Pedro,
Articles W